Hatena::Groupbioruby

"aac".translate #=> "N" このページをアンテナに追加 RSSフィード

2008-01-10

H-InvDB REST web service client class added

|  H-InvDB REST web service client class added - "aac".translate #=> "N" を含むブックマーク はてなブックマーク -  H-InvDB REST web service client class added - "aac".translate #=> "N"  H-InvDB REST web service client class added - "aac".translate #=> "N" のブックマークコメント

Katayama-san commited a new IO class Bio::Hinv to access the H-InvDB REST web service.

H-InvDB web service provides 12 APIs.

acc2hit - HIT ID of accession number

URI:

Output:

<?xml version='1.0' encoding='UTF-8'?>
<H-Inv>
        <H-INVITATIONAL-ID>HIT000053961</H-INVITATIONAL-ID>
</H-Inv>

In bioruby,

irb(main):001:0> require 'bio'
irb(main):002:0> Bio::Hinv.acc2hit("BC053657")
=> "HIT000053961"

hit2acc - Accession No of HIT ID

URI:

Output:

<?xml version='1.0' encoding='UTF-8'?>
<H-Inv>
        <ACCESSION-NO>AK097327</ACCESSION-NO>
</H-Inv>% 

In bioruby:

irb(main):003:0> Bio::Hinv.hit2acc("HIT000022181") 
=> "AK097327"

hit_cnt - total number of HIT ID

URI:

Output:

<?xml version='1.0' encoding='UTF-8'?>
<H-Inv>
        <TRANSCRIPT_CNT>187156</TRANSCRIPT_CNT>
</H-Inv>

The last line don't have return code.

In bioruby:

irb(main):004:0> Bio::Hinv.hit_cnt 
=> 187156

hit_definition - HIT definition of HIT ID

URI:

Output:

<?xml version='1.0' encoding='UTF-8'?>
<H-Inv>
        <HIT_FUNCTION>
                <H-INVITATIONAL-ID>HIT000000001</H-INVITATIONAL-ID>
                <DATA-SOURCE_DEFINITION>Rho guanine nucleotide exchange factor 10.</DATA-SOURCE_DEFINITION>
                <CDNA_REP-H-INVITATIONAL>Representative transcript</CDNA_REP-H-INVITATIONAL>
                <CDNA_SPLICING-ISOFORM_CURATION></CDNA_SPLICING-ISOFORM_CURATION>
                <DATA-SOURCE_DB-REFERENCE_PROTEIN-MOTIF-ID>NP_055444</DATA-SOURCE_DB-REFERENCE_PROTEIN-MOTIF-ID>
                <DATA-SOURCE_IDENTITY>100.0</DATA-SOURCE_IDENTITY>
                <DATA-SOURCE_COVERAGE>100.0</DATA-SOURCE_COVERAGE>
                <DATA-SOURCE_HOMOLOGOUS_SPECIES>Homo sapiens</DATA-SOURCE_HOMOLOGOUS_SPECIES>
                <DATA-SOURCE_SIMILARITY-CATEGORY>Identical to known human protein(Category I).</DATA-SOURCE_SIMILARITY-CATEGORY>
        </HIT_FUNCTION>
</H-Inv>

In bioruby:

simple access

irb(main):006:0> Bio::Hinv.hit_definition("HIT000000001") 
=> "Rho guanine nucleotide exchange factor 10."

and full access

irb(main):007:0> serv = Bio::Hinv::HitDefinition.new
irb(main):008:0> serv.query("hit" => "HIT000000001")
irb(main):009:0> serv.result
=> "Rho guanine nucleotide exchange factor 10."
irb(main):010:0> serv.data_source_definition
=> "Rho guanine nucleotide exchange factor 10."
irb(main):011:0> serv.cdna_rep_h_invitational
=> "Representative transcript"
irb(main):012:0> serv.cdna_splicing_isoform_curation
=> nil
irb(main):013:0> serv.data_source_db_reference_protein_motif_id
=> "NP_055444"
irb(main):014:0> serv.data_source_identity
=> 100.0
irb(main):015:0> serv.data_source_coverage
=> 100.0
irb(main):016:0> serv.data_source_homologous_species
=> "Homo sapiens"
irb(main):017:0> serv.data_source_similarity_category
=> "Identical to known human protein(Category I)."

hit_pubmedid - PMID of HIT ID

URI:

Output:

<?xml version='1.0' encoding='UTF-8'?>
<H-Inv>
<CDNA_DB-REFERENCE_PUBMED>7624364</CDNA_DB-REFERENCE_PUBMED>
<CDNA_DB-REFERENCE_PUBMED>11279095</CDNA_DB-REFERENCE_PUBMED>
<CDNA_DB-REFERENCE_PUBMED>15489334</CDNA_DB-REFERENCE_PUBMED>
</H-Inv>

In bioruby:

irb(main):031:0> Bio::Hinv.hit_pubmedid("HIT000053961")
=> [7624364, 11279095, 15489334]

hit_xml - HIT XML file of HIT ID

URI:

Output:

<?xml version="1.0" standalone="yes" ?>
<H-Inv>
  <cDNAXML>
    <CLUSTER-ID>HIX0021591</CLUSTER-ID>
    <CLUSTER-ID-VERSION>HIX0021591.11</CLUSTER-ID-VERSION>
    <H-INVITATIONAL-ID>HIT000000001</H-INVITATIONAL-ID>
    <H-INVITATIONAL-ID-VERSION>HIT000000001.11</H-INVITATIONAL-ID-VERSION>
    <ACCESSION-NO>AB002292</ACCESSION-NO>
    <ACCESSION-NO-VERSION>AB002292.2</ACCESSION-NO-VERSION>
    <GENOME-STATISTICS>build 36.2</GENOME-STATISTICS>
    <DIVISION>HUM</DIVISION>
    <MOL-TYPE>mRNA</MOL-TYPE>
    <CDNA_DATE-CREATE>14-Feb-2004</CDNA_DATE-CREATE>
    <CDNA_DATE-LAST-UPDATE>26-Dec-2007</CDNA_DATE-LAST-UPDATE>
    <CDNA_DATE-LAST-MODIFIED>26-Dec-2007</CDNA_DATE-LAST-MODIFIED>
    <CDNA_H-INV-DB-RELEASE>5.0</CDNA_H-INV-DB-RELEASE>
    <HIT-RELEASE>5.0</HIT-RELEASE>
    <CDNA_DATE-ANNOTATION-LAST-UPDATE>26-Dec-2007</CDNA_DATE-ANNOTATION-LAST-UPDATE>
    <CDNA_DATE-ANNOTATION-LAST-MODIFIED>26-Dec-2007</CDNA_DATE-ANNOTATION-LAST-MODIFIED>
    <HIT-ANNOTATION-RELEASE>5.0</HIT-ANNOTATION-RELEASE>
    <CHROMOSOME-NUMBER>8</CHROMOSOME-NUMBER>
    <CHROMOSOME-BAND>8p23.3</CHROMOSOME-BAND>
    <CDNA_START>1759549</CDNA_START>
    <CDNA_END>1894206</CDNA_END>
    <CDNA_STRAND>+</CDNA_STRAND>
    <CDNA_LOCUS_START>1</CDNA_LOCUS_START>
    <CDNA_LOCUS_END>134658</CDNA_LOCUS_END>
    <CDNA_DB-REFERENCE_KEGG-GENES>9639</CDNA_DB-REFERENCE_KEGG-GENES>
    <CDNA_DB-REFERENCE_ENSEMBL>ENST00000262112</CDNA_DB-REFERENCE_ENSEMBL>
    <CDNA_DB-REFERENCE_ENSEMBL>ENST00000349830</CDNA_DB-REFERENCE_ENSEMBL>
    <CDNA_DB-REFERENCE_ENSEMBL>ENST00000382794</CDNA_DB-REFERENCE_ENSEMBL>
    <CDNA_DB-REFERENCE_ENSEMBL>ENST00000382795</CDNA_DB-REFERENCE_ENSEMBL>
    <CDNA_DB-REFERENCE_ENTREZGENE>9639</CDNA_DB-REFERENCE_ENTREZGENE>
    <CDNA_DB-REFERENCE_CCDS>CCDS34794</CDNA_DB-REFERENCE_CCDS>
    <CDNA_DB-REFERENCE_REFSEQ>NM_014629</CDNA_DB-REFERENCE_REFSEQ>
    <CDNA_REP-H-INVITATIONAL>Representative transcript</CDNA_REP-H-INVITATIONAL>
    <CDNA_SPLICE-ACCEPTOR>CAGAAG</CDNA_SPLICE-ACCEPTOR>
    <CDNA_SPLICE-ACCEPTOR>CAGCAG</CDNA_SPLICE-ACCEPTOR>
    <CDNA_SPLICE-ACCEPTOR>CAGGAG</CDNA_SPLICE-ACCEPTOR>
    <CDNA_H-INVITATIONAL-PROTEIN-ID>HIP000042367</CDNA_H-INVITATIONAL-PROTEIN-ID>
    <CDNA_H-INVITATIONAL-PROTEIN-ID-VERSION>HIP000042367.1</CDNA_H-INVITATIONAL-PROTEIN-ID-VERSION>
    <CDNA_DB-REFERENCE_REFSEQ-PROTEIN-ID>NP_055444</CDNA_DB-REFERENCE_REFSEQ-PROTEIN-ID>
    <JOURNAL_DB-REFERENCE_MEDLINE>15103394</JOURNAL_DB-REFERENCE_MEDLINE>
    <MRNA-INSPECTION>
      <CLONE-NUMBER_ORIGINAL>hf00223s1</CLONE-NUMBER_ORIGINAL>
      <TISSUE-TYPE-ORIGIN_ORIGINAL>brain</TISSUE-TYPE-ORIGIN_ORIGINAL>
      <DATA-PROVIDER>KDRI</DATA-PROVIDER>
      <LENGTH-OF-CDNA_ORIGINAL>5589</LENGTH-OF-CDNA_ORIGINAL>
      <NUMBER-OF-EXON_ORIGINAL>29</NUMBER-OF-EXON_ORIGINAL>
      <NUMBER-OF-A_ORIGINAL>1495</NUMBER-OF-A_ORIGINAL>
      <NUMBER-OF-T_ORIGINAL>1244</NUMBER-OF-T_ORIGINAL>
      <NUMBER-OF-G_ORIGINAL>1467</NUMBER-OF-G_ORIGINAL>
      <NUMBER-OF-C_ORIGINAL>1383</NUMBER-OF-C_ORIGINAL>
    </MRNA-INSPECTION>
    <PATHOLOGY>
      <PATHOLOGY_DATE-LAST-UPDATE>26-Dec-2007</PATHOLOGY_DATE-LAST-UPDATE>
      <PATHOLOGY_DATE-LAST-MODIFIED>31-Mar-2003</PATHOLOGY_DATE-LAST-MODIFIED>
      <PATHOLOGY_DISEASE-RELEASE>5.0</PATHOLOGY_DISEASE-RELEASE>
      <KNOWN-DISEASE-GENE>
        <CDNA-OMIM_DB-REFERENCE_OMIM-DISEASE>608236</CDNA-OMIM_DB-REFERENCE_OMIM-DISEASE>
        <CDNA-OMIM_DISEASE_DISEASE-NAME>Slowed nerve conduction velocity, AD</CDNA-OMIM_DISEASE_DISEASE-NAME>
        <CDNA-OMIM_DB-REFERENCE_OMIM>608136</CDNA-OMIM_DB-REFERENCE_OMIM>
        <CDNA-OMIM_MORBID-MAP_OMIM-TITLE>RHO GUANINE NUCLEOTIDE EXCHANGE FACTOR 10</CDNA-OMIM_MORBID-MAP_OMIM-TITLE>
      </KNOWN-DISEASE-GENE>
      <ORPHAN-DISEASE_DB-REFERENCE_LOCUS-OMIM>148370</ORPHAN-DISEASE_DB-REFERENCE_LOCUS-OMIM>
      <ORPHAN-DISEASE_DB-REFERENCE_LOCUS-OMIM>606129</ORPHAN-DISEASE_DB-REFERENCE_LOCUS-OMIM>
      <ORPHAN-DISEASE_DB-REFERENCE_LOCUS-OMIM>606662</ORPHAN-DISEASE_DB-REFERENCE_LOCUS-OMIM>
      <ORPHAN-DISEASE_DB-REFERENCE_LOCUS-OMIM>609259</ORPHAN-DISEASE_DB-REFERENCE_LOCUS-OMIM>
    </PATHOLOGY>
    <EVOLUTIONARY-FEATURE>
      <EVOLUTIONARY-FEATURE_DATE-LAST-UPDATE>26-Dec-2007</EVOLUTIONARY-FEATURE_DATE-LAST-UPDATE>
      <EVOLUTIONARY-FEATURE_DATE-LAST-MODIFIED>26-Dec-2007</EVOLUTIONARY-FEATURE_DATE-LAST-MODIFIED>
      <EVOLUTIONARY-FEATURE_EVOLUTION-RELEASE>5.0</EVOLUTIONARY-FEATURE_EVOLUTION-RELEASE>
      <ORTHOLOGY>
        <ACCESSION-NO>AK147669</ACCESSION-NO>
        <SPECIES>Mus musculus (Mouse)</SPECIES>
        <MGI-ID>MGI:3573648</MGI-ID>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>BC059220</ACCESSION-NO>
        <SPECIES>Mus musculus (Mouse)</SPECIES>
        <MGI-ID>MGI:1920004</MGI-ID>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>BC114112</ACCESSION-NO>
        <SPECIES>Bos taurus (Cow)</SPECIES>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>CR391701</ACCESSION-NO>
        <SPECIES>Gallus gallus (Chicken)</SPECIES>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>ENSCAFT00000024924</ACCESSION-NO>
        <SPECIES>Canis familiaris (Dog)</SPECIES>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>ENSORLT00000021592</ACCESSION-NO>
        <SPECIES>Oryzias Latipes (Medaka)</SPECIES>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>ENSRNOT00000016745</ACCESSION-NO>
        <SPECIES>Rattus norvegicus (Rat)</SPECIES>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>GSTENT00032455001</ACCESSION-NO>
        <SPECIES>Tetraodon nigroviridis (Tetraodon)</SPECIES>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>SINFRUT00000172682</ACCESSION-NO>
        <SPECIES>Takifugu rubripes (Fugu)</SPECIES>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>XM_001343066</ACCESSION-NO>
        <SPECIES>Danio rerio (Zebrafish)</SPECIES>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>XM_001381452</ACCESSION-NO>
        <SPECIES>Monodelphis domestica (Opossum)</SPECIES>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>XM_001488501</ACCESSION-NO>
        <SPECIES>Equus caballus (Horse)</SPECIES>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>XM_528056</ACCESSION-NO>
        <SPECIES>Pan troglodytes (Chimpanzee)</SPECIES>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>XM_680636</ACCESSION-NO>
        <SPECIES>Danio rerio (Zebrafish)</SPECIES>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>XM_680883</ACCESSION-NO>
        <SPECIES>Danio rerio (Zebrafish)</SPECIES>
      </ORTHOLOGY>
      <ORTHOLOGY>
        <ACCESSION-NO>XM_846774</ACCESSION-NO>
        <SPECIES>Canis familiaris (Dog)</SPECIES>
      </ORTHOLOGY>
    </EVOLUTIONARY-FEATURE>
    <CDNA-INFO>
      <SNP>
        <SNP_START>325</SNP_START>
        <SNP_END>325</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs4875950</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>A/C</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[Pro47Pro]</SNP_TRANSLATION>
        <SNP_STRAND>-</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>571</SNP_START>
        <SNP_END>571</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs749822</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>A/G</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[Val129Val]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>775</SNP_START>
        <SNP_END>775</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs2272708</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>C/T</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[Ala197Ala]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>814</SNP_START>
        <SNP_END>814</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs7003969</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>G/A</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[Glu210Glu]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>1294</SNP_START>
        <SNP_END>1294</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs9657362</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>G/C</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Nonsynonymous[Leu370Phe]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>1297</SNP_START>
        <SNP_END>1297</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs34655804</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>C/T</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[Phe371Phe]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>1615</SNP_START>
        <SNP_END>1615</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs3758004</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>C/T</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[Phe477Phe]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>1831</SNP_START>
        <SNP_END>1831</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs12681485</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>C/T</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[Leu549Leu]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>1938</SNP_START>
        <SNP_END>1938</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs1045489</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>G/A</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Nonsynonymous[Arg585Lys]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>2175</SNP_START>
        <SNP_END>2175</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs34319003</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>T/C</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Nonsynonymous[Met664Thr]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>2239</SNP_START>
        <SNP_END>2239</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs2294038</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>T/C</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[Tyr685Tyr]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>2282</SNP_START>
        <SNP_END>2282</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs2294039</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>G/A</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Nonsynonymous[Val700Ile]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>2287</SNP_START>
        <SNP_END>2287</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs2294040</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>C/T</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[His701His]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>2569</SNP_START>
        <SNP_END>2569</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs34036746</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>C/T</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[Asp795Asp]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>2764</SNP_START>
        <SNP_END>2764</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs2272613</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>C/T</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[Pro860Pro]</SNP_TRANSLATION>
        <SNP_STRAND>-</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>2920</SNP_START>
        <SNP_END>2920</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs2272611</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>C/T</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[Ile912Ile]</SNP_TRANSLATION>
        <SNP_STRAND>-</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>2939</SNP_START>
        <SNP_END>2939</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs35354057</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>A/C</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Nonsynonymous[Thr919Pro]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>3093</SNP_START>
        <SNP_END>3093</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs35925274</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>C/T</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Nonsynonymous[Thr970Met]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>3134</SNP_START>
        <SNP_END>3134</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs17683288</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>T/G</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Nonsynonymous[Ser984Ala]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>3200</SNP_START>
        <SNP_END>3200</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs2272610</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>A/T</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Nonsynonymous[Thr1006Ser]</SNP_TRANSLATION>
        <SNP_STRAND>-</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>3232</SNP_START>
        <SNP_END>3233</SNP_END>
        <SNP_LOCATION-TYPE>^</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs35849152</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>-/G</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>3598</SNP_START>
        <SNP_END>3598</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs2272609</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>G/A</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[Ser1138Ser]</SNP_TRANSLATION>
        <SNP_STRAND>-</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>3622</SNP_START>
        <SNP_END>3622</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs2272608</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>C/T</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[His1146His]</SNP_TRANSLATION>
        <SNP_STRAND>-</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>3922</SNP_START>
        <SNP_END>3922</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs3735876</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>G/A</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Synonymous[Ser1246Ser]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>4157</SNP_START>
        <SNP_END>4157</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs35095003</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>C/T</SNP_BASE-CDNA>
        <SNP_LOCATION>CDS</SNP_LOCATION>
        <SNP_TRANSLATION>Nonsynonymous[Pro1325Ser]</SNP_TRANSLATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>4518</SNP_START>
        <SNP_END>4518</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs6558566</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>A/G</SNP_BASE-CDNA>
        <SNP_LOCATION>3'UTR</SNP_LOCATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>4613</SNP_START>
        <SNP_END>4613</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs6991392</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>A/G</SNP_BASE-CDNA>
        <SNP_LOCATION>3'UTR</SNP_LOCATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>5420</SNP_START>
        <SNP_END>5420</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs14375</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>T/G</SNP_BASE-CDNA>
        <SNP_LOCATION>3'UTR</SNP_LOCATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <SNP>
        <SNP_START>5499</SNP_START>
        <SNP_END>5499</SNP_END>
        <SNP_LOCATION-TYPE>..</SNP_LOCATION-TYPE>
        <SNP_DB-REFERENCE_DBSNP>rs11986753</SNP_DB-REFERENCE_DBSNP>
        <SNP_BASE-CDNA>T/C</SNP_BASE-CDNA>
        <SNP_LOCATION>3'UTR</SNP_LOCATION>
        <SNP_STRAND>+</SNP_STRAND>
      </SNP>
      <EXON-CDNA>
        <EXON-CDNA_START>1</EXON-CDNA_START>
        <EXON-CDNA_END>137</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>138</EXON-CDNA_START>
        <EXON-CDNA_END>221</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>222</EXON-CDNA_START>
        <EXON-CDNA_END>377</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>378</EXON-CDNA_START>
        <EXON-CDNA_END>665</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>666</EXON-CDNA_START>
        <EXON-CDNA_END>729</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>730</EXON-CDNA_START>
        <EXON-CDNA_END>806</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>807</EXON-CDNA_START>
        <EXON-CDNA_END>863</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>864</EXON-CDNA_START>
        <EXON-CDNA_END>1027</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>1028</EXON-CDNA_START>
        <EXON-CDNA_END>1144</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>1145</EXON-CDNA_START>
        <EXON-CDNA_END>1259</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>1260</EXON-CDNA_START>
        <EXON-CDNA_END>1366</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>1367</EXON-CDNA_START>
        <EXON-CDNA_END>1444</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>1445</EXON-CDNA_START>
        <EXON-CDNA_END>1624</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>1625</EXON-CDNA_START>
        <EXON-CDNA_END>1741</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>1742</EXON-CDNA_START>
        <EXON-CDNA_END>1834</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>1835</EXON-CDNA_START>
        <EXON-CDNA_END>2005</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>2006</EXON-CDNA_START>
        <EXON-CDNA_END>2151</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>2152</EXON-CDNA_START>
        <EXON-CDNA_END>2327</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>2328</EXON-CDNA_START>
        <EXON-CDNA_END>2443</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>2444</EXON-CDNA_START>
        <EXON-CDNA_END>2571</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>2572</EXON-CDNA_START>
        <EXON-CDNA_END>2672</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>2673</EXON-CDNA_START>
        <EXON-CDNA_END>2794</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>2795</EXON-CDNA_START>
        <EXON-CDNA_END>2881</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>2882</EXON-CDNA_START>
        <EXON-CDNA_END>3105</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>3106</EXON-CDNA_START>
        <EXON-CDNA_END>3263</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>3264</EXON-CDNA_START>
        <EXON-CDNA_END>3406</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>3407</EXON-CDNA_START>
        <EXON-CDNA_END>3581</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>3582</EXON-CDNA_START>
        <EXON-CDNA_END>3704</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-CDNA>
        <EXON-CDNA_START>3705</EXON-CDNA_START>
        <EXON-CDNA_END>5589</EXON-CDNA_END>
      </EXON-CDNA>
      <EXON-GENOME>
        <EXON-GENOME_START>1759549</EXON-GENOME_START>
        <EXON-GENOME_END>1759686</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1778926</EXON-GENOME_START>
        <EXON-GENOME_END>1779009</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1793533</EXON-GENOME_START>
        <EXON-GENOME_END>1793688</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1795470</EXON-GENOME_START>
        <EXON-GENOME_END>1795757</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1799946</EXON-GENOME_START>
        <EXON-GENOME_END>1800009</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1802099</EXON-GENOME_START>
        <EXON-GENOME_END>1802175</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1804767</EXON-GENOME_START>
        <EXON-GENOME_END>1804823</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1812144</EXON-GENOME_START>
        <EXON-GENOME_END>1812307</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1815621</EXON-GENOME_START>
        <EXON-GENOME_END>1815737</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1818208</EXON-GENOME_START>
        <EXON-GENOME_END>1818322</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1821174</EXON-GENOME_START>
        <EXON-GENOME_END>1821280</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1829142</EXON-GENOME_START>
        <EXON-GENOME_END>1829219</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1829966</EXON-GENOME_START>
        <EXON-GENOME_END>1830145</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1831906</EXON-GENOME_START>
        <EXON-GENOME_END>1832022</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1834006</EXON-GENOME_START>
        <EXON-GENOME_END>1834098</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1838854</EXON-GENOME_START>
        <EXON-GENOME_END>1839024</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1841144</EXON-GENOME_START>
        <EXON-GENOME_END>1841289</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1844868</EXON-GENOME_START>
        <EXON-GENOME_END>1845043</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1858537</EXON-GENOME_START>
        <EXON-GENOME_END>1858652</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1859041</EXON-GENOME_START>
        <EXON-GENOME_END>1859168</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1859347</EXON-GENOME_START>
        <EXON-GENOME_END>1859447</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1860856</EXON-GENOME_START>
        <EXON-GENOME_END>1860977</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1861950</EXON-GENOME_START>
        <EXON-GENOME_END>1862036</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1864000</EXON-GENOME_START>
        <EXON-GENOME_END>1864223</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1864859</EXON-GENOME_START>
        <EXON-GENOME_END>1865016</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1869373</EXON-GENOME_START>
        <EXON-GENOME_END>1869515</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1881054</EXON-GENOME_START>
        <EXON-GENOME_END>1881228</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1888278</EXON-GENOME_START>
        <EXON-GENOME_END>1888400</EXON-GENOME_END>
      </EXON-GENOME>
      <EXON-GENOME>
        <EXON-GENOME_START>1892322</EXON-GENOME_START>
        <EXON-GENOME_END>1894206</EXON-GENOME_END>
      </EXON-GENOME>
    </CDNA-INFO>
    <SEQUENCE>
      <NUCLEOTIDE_ORIGINAL>GGGGTCGCGGGGGACGCGGGGGACGCGGGGGACGCGGGGGACGGCGGGGAACGGCGGGGAACAGCGGGGGACGGCGGGGAACAGCGGGGGACGGCGGGGAACAGCAGGGGACTGCGGGTCGCGTCCTGGCCGCCGAGGAGCTCCTTCCCTTAACAGAGCTGAGAGAGGCATCTGGAGCTGCAGCATGGACCAGCGAGAGCCCCTGCCTCCCGCTCCTGCAGAAAATGAAATGAAATATGATACCAATAATAATGAAGAGGAAGAGGGAGAACAGTTCGATTTTGACAGTGGAGATGAAATCCCAGAAGCGGACAGACAGGCCCCATCCGCCCCTGAGACAGGAGGTGCTGGAGCCAGTGAAGCCCCTGCACCCACAGGAGGTGAGGATGGAGCTGGAGCAGAAACCACCCCAGTGGCAGAGCCTACTAAGCTGGTGCTCCCGATGAAAGTCAACCCATATTCTGTCATCGACATCACGCCATTCCAGGAGGACCAGCCGCCCACCCCCGTGCCCAGCGCTGAGGAGGAGAATGTGGGTCTCCATGTGCCCTGCGGGTACTTGGTGCCTGTACCCTGCGGCTATGCGGTGCCCTCCAACCTGCCCCTCCTGCTGCCCGCCTACTCCAGCCCGGTCATCATCTGCGCCACGTCCCTGGACGAAGAAGAAACACCAGAAGTCACAGAAGATCGCCAGCCCAATTCTCTGAGTTCCGAGGAGCCTCCAACCAGTGAAGATCAAGTCGGTCGAGAGGACAGCGCACTTGCCCGCTGGGCCGCAGACCCGGCCAACACAGCCTGGATGGAGAATCCAGAGGAAGCAATTTACGATGACGTTCCAAGGGAAAACTCAGACTCTGAACCAGATGAAATGATTTATGATGATGTTGAGAATGGGGATGAAGGTGGAAACAGCTCCTTGGAATACGGATGGAGTTCGAGTGAATTTGAAAGTTACGAAGAGCAGAGTGACTCGGAGTGCAAGAATGGGATTCCCAGGTCCTTCCTGCGCAGCAACCACAAAAAGCAACTTTCTCATGACCTAACCCGTTTAAAGGAGCACTATGAGAAAAAGATGAGAGATTTGATGGCAAGCACGGTGGGCGTGGTGGAGATTCAGCAGCTCAGGCAGAAGCATGAACTGAAGATGCAGAAGCTCGTGAAGGCCGCGAAGGACGGCACCAAGGACGGGCTGGAGAGGACCAGGGCAGCCGTGAAGAGGGGCCGCTCCTTCATCAGGACCAAGTCTCTCATCGCACAGGATCACAGATCTTCTCTTGAGGAAGAACAGAATTTGTTCATTGATGTTGACTGCAAGCACCCGGAAGCCATCTTGACCCCGATGCCCGAGGGTTTATCTCAGCAGCAGGTTGTAAGAAGATATATACTGGGTTCAGTTGTCGACAGTGAAAAGAACTACGTAGATGCTCTTAAGAGGATTTTGGAGCAATATGAGAAGCCGCTGTCTGAGATGGAGCCAAAGGTTCTGAGTGAGAGGAAGCTGAAGACGGTGTTCTACCGAGTCAAAGAGATCCTGCAGTGCCACTCGCTATTTCAGATCGCGCTGGCCAGCCGCGTTTCCGAGTGGGACTCCGTGGAAATGATAGGCGATGTCTTCGTGGCTTCGTTTTCTAAGTCCATGGTGCTGGATGCATACAGTGAATATGTGAACAATTTCAGCACAGCCGTGGCAGTCCTCAAGAAAACATGTGCCACAAAGCCCGCTTTTCTTGAATTTTTAAAGCAGGAACAGGAGGCCAGCCCCGATCGAACCACGCTCTACAGCCTGATGATGAAGCCCATCCAGAGGTTCCCACAGTTCATCCTCCTGCTCCAGGACATGCTGAAGAACACCTCCAAAGGCCACCCCGACAGGCTGCCTCTTCAGATGGCCCTGACAGAGCTCGAAACACTAGCAGAGAAGTTAAATGAAAGAAAGAGAGATGCTGATCAACGCTGTGAAGTGAAGCAAATAGCCAAAGCCATAAACGAAAGATACCTGAACAAGCTTCTCAGCAGTGGAAGCCGATACCTCATTCGATCAGATGATATGATAGAAACAGTTTACAACGACAGAGGAGAGATTGTTAAAACCAAAGAACGCCGAGTCTTCATGTTAAATGATGTGTTAATGTGTGCCACCGTCAGCTCACGCCCCTCTCATGACAGCCGTGTGATGAGCAGCCAGAGGTACTTGCTGAAGTGGAGCGTTCCACTGGGACATGTGGACGCCATCGAGTATGGCAGCAGCGCAGGCACGGGCGAGCACAGCAGGCACCTTGCCGTTCACCCGCCGGAGAGCCTGGCCGTGGTTGCTAACGCGAAACCAAACAAAGTTTACATGGGGCCAGGACAACTGTATCAAGATTTACAAAACTTGTTGCATGACTTAAATGTAATTGGCCAAATCACTCAGCTGATAGGAAACCTTAAAGGAAACTATCAGAACTTAAACCAGTCAGTAGCCCATGACTGGACATCAGGTTTACAAAGGCTTATTTTGAAGAAAGAAGATGAAATCAGAGCTGCGGACTGCTGCAGAATTCAGTTACAGCTTCCCGGGAAGCAGGACAAATCTGGGCGACCGACGTTCTTTACAGCTGTGTTCAATACGTTCACCCCTGCCATCAAGGAGTCCTGGGTCAACAGCTTACAGATGGCCAAGCTCGCCCTAGAAGAGGAGAACCACATGGGCTGGTTCTGTGTGGAAGACGATGGGAATCACATTAAAAAGGAGAAGCATCCTCTCCTCGTCGGACACATGCCCGTGATGGTGGCCAAGCAGCAGGAGTTCAAGATTGAATGTGCTGCTTATAACCCTGAACCTTACCTAAATAATGAAAGCCAGCCAGATTCATTTTCCACGGCACATGGTTTCCTGTGGATCGGAAGTTGCACCCATCAAATGGGTCAGATTGCCATCGTCTCGTTTCAAAATTCCACTCCCAAAGTCATTGAGTGCTTCAACGTGGAATCTCGCATCCTGTGCATGCTGTACGTTCCCGTCGAGGAGAAGCGCAGAGAGCCTGGGGCACCCCCGGACCCCGAGACCCCGGCCGTGAGAGCTTCTGATGTCCCCACGATCTGTGTAGGGACGGAGGAGGGAAGCATTTCCATTTATAAAAGCAGTCAAGGCTCCAAGAAAGTGAGACTTCAGCACTTTTTCACTCCTGAGAAGTCCACAGTCATGAGCCTGGCTTGCACGTCTCAGAGCCTGTACGCTGGCCTGGTCAACGGGGCAGTCGCCAGCTACGCCAGAGCCCCAGATGGATCCTGGGATTCAGAACCTCAAAAAGTGATCAAGTTAGGCGTCCTACCAGTTAGAAGTCTACTCATGATGGAAGACACGTTGTGGGCGGCTTCCGGAGGTCAAGTCTTCATCATCAGTGTGGAGACTCATGCTGTAGAGGGTCAGCTGGAGGCCCACCAGGAGGAAGGCATGGTGATCTCCCACATGGCCGTGTCCGGCGTCGGGATCTGGATTGCCTTCACCTCAGGGTCCACGCTCCGCCTTTTTCACACGGAAACTCTCAAGCACCTGCAGGACATCAACATCGCCACCCCTGTTCACAACATGCTGCCAGGGCACCAGCGGCTGTCGGTGACGAGCCTGCTCGTCTGCCACGGATTGCTGATGGTCGGCACCAGCCTGGGAGTCCTCGTGGCCCTGCCGGTCCCACGTCTGCAAGGGATTCCCAAAGTGACCGGAAGAGGCATGGTCTCCTACCATGCACACAACAGTCCTGTCAAATTCATCGTCCTGGCCACGGCTCTGCACGAGAAAGACAAGGACAAATCCAGGGACAGCCTGGCTCCTGGCCCCGAGCCTCAGGACGAAGACCAGAAGGACGCACTTCCGAGTGGAGGAGCTGGTTCATCTCTGAGCCAGGGTGACCCTGACGCAGCCATCTGGTTGGGAGATTCGCTGGGATCGATGACTCAGAAAAGCGACCTGTCCTCCTCATCTGGGTCCCTGAGCTTGTCTCACGGCTCCAGCTCTCTAGAGCACAGATCAGAGGACAGCACCATCTATGATCTCCTGAAGGATCCTGTCTCGCTGAGAAGCAAAGCACGCCGGGCCAAGAAAGCCAAGGCCAGCTCGGCGCTGGTGGTCTGTGGAGGGCAGGGCCACCGCCGGGTGCACAGGAAGGCCCGGCAGCCCCACCAGGAAGAGCTGGCGCCGACCGTCATGGTCTGGCAGATCCCTCTGCTGAATATATAAGCAGGACGGCCGCCTTCTGCTGTCAGAATTTGCAATCAAGGGTGACTTCTCAGCTAATCCTACAGCCTGAGTGGTTAAGCTGTGTCTACACTGGTTGGGAATAAATTAAAAACAGTATTTGGGGGAGAAACGTGCAATAGCGTAATGGTGGTGTCCCTGCCAATTCCTTCCTTCTCTTCTGTACAGCAGAAGTAATTACAAGCACTTCTCACGAAGGCAGAAGACTGATGCAATTTTCGAGTAATTGAGTGCAGTTCTGGGAAAATACCACATTCTTTTTGACTGCTGTAGTCCATATATGAATACTAAATGTTAAACTTCATCAGCGTCAGACCTATTGTATCATATTAGAGAATTTGCAGACTAAGAATTTATGAGAAAATATATGTATTCAGTAGTGCAGGCATTTATTAACAATTCTTAAAAGTTTTACCTGATTCAGATTCACGACTTTTATTTATATTCTATATTTTTGAATTTCAGAGTAAAATTTGTTAACAATTTTAAAAGCCAGGTAACACCTACCAGTCCAGTTAGCATGATTTGCTTTCAGAAGTGAGCTGGGTTTTCCAAAGTGGTATAATGTGTGTACTGTATATTTTAACAAAGTAATATTTTTGTATTGCATTTTTCTATTAAAAAATTAACAGTTAATGTTTCAGTCAATGTATTATCTGTAGCATTTCACAAATAATGTTTGCTTTGAACCAAAATGCTCAGTGCCTATCAACATTTGGACTCAAGCATCAACACCAAATTATTCCTCCCTTCTCGTATAAATAGAGTGACTATCCACAGGAGAAAAGTGTGTGCTTTAGTATTAGAGGAGATAGGCAGAGAAGTCTTGCTTAGTTCCTTCGTGCAGCTTCTTGCCCCTGTTGACGTGGAATGCTGTGTCTGCTTTAGCACGCACGCTCCGAATGACTCCTGGTGCTAGGCCATGCTGGCTGCTGTCACTGAGCGGGACTCAGGCCAAGAGGCGTGACCTCGGGCCAGCCTGTCTGTTGTGCAGACGCCTCCTCTGCAGAACGCATCAGTTTCTATTCTGCAGTTGCAGAGCCAGCCCCGCGTGAGAACGTGCATAATGAGTGCACACCATCATGTCAAGGTGCATACTTAGTGAGCGCCATCCTGCTGAACGTGTATTTCAGTGTTTCACTTACTGGACGGATAACAAGAAAAAAATCCTAACACAGGCAGTCACCAGAAATAAATGTCTCAGCACTTTACAGATGACTAAAAATGTTAATTTTATGACTTAGCCAAATATGTTCTAGGTTGCATATATCCCCCATGTGAAAGTGATTTCTTCCCAAGCTTCTCAAACTGTTAGCTGCTGTCTGACTTCATCAATAAAGTATTTTTATTTT</NUCLEOTIDE_ORIGINAL>
    </SEQUENCE>
    <PREDICTED-ORF>
      <CODING-POTENTIAL>Protein coding</CODING-POTENTIAL>
      <CDS_SOURCE_START>1</CDS_SOURCE_START>
      <CDS_SOURCE_END>5589</CDS_SOURCE_END>
      <CDS_START>185</CDS_START>
      <CDS_END>4219</CDS_END>
      <LENGTH-OF-CDS>1344</LENGTH-OF-CDS>
      <ORIENTATION>forward</ORIENTATION>
      <FRAME>+2</FRAME>
      <FEATURE>Complete CDS</FEATURE>
      <CAI>0.769</CAI>
    </PREDICTED-ORF>
    <FUNCTION>
      <DEFINITION>
        <DATA-SOURCE_DB-REFERENCE_PROTEIN-MOTIF-ID>NP_055444</DATA-SOURCE_DB-REFERENCE_PROTEIN-MOTIF-ID>
        <DATA-SOURCE_IDENTITY>100.0</DATA-SOURCE_IDENTITY>
        <DATA-SOURCE_COVERAGE>100.0</DATA-SOURCE_COVERAGE>
        <DATA-SOURCE_HOMOLOGOUS_SPECIES>Homo sapiens</DATA-SOURCE_HOMOLOGOUS_SPECIES>
        <DATA-SOURCE_CURATION-STATUS>Human curated</DATA-SOURCE_CURATION-STATUS>
        <DATA-SOURCE_DEFINITION>Rho guanine nucleotide exchange factor 10.</DATA-SOURCE_DEFINITION>
        <DATA-SOURCE_SIMILARITY-CATEGORY>Identical to known human protein(Category I).</DATA-SOURCE_SIMILARITY-CATEGORY>
        <EXP-EVIDENCE>Protein evidence</EXP-EVIDENCE>
        <EXP-CODE>1</EXP-CODE>
        <GENENAME-SYMBOL_DDBJ-EMBL-GenBank>KIAA0294</GENENAME-SYMBOL_DDBJ-EMBL-GenBank>
        <GENE-FAMILY_NAME>DH (IPR000219).</GENE-FAMILY_NAME>
        <GENE-FAMILY_HIF-ID>HIF0003409</GENE-FAMILY_HIF-ID>
        <GENE-FAMILY-EVIDENCE-MOTIF>IPR000219</GENE-FAMILY-EVIDENCE-MOTIF>
      </DEFINITION>
      <GENE-ONTOLOGY>
        <DOMAIN_DB-REFERENCE_INTERPRO>IPR000219</DOMAIN_DB-REFERENCE_INTERPRO>
        <DOMAIN_NAME>DH</DOMAIN_NAME>
        <DOMAIN_TYPE>Domain</DOMAIN_TYPE>
        <DOMAIN>
          <DOMAIN_MOTIF_START>1346</DOMAIN_MOTIF_START>
          <DOMAIN_MOTIF_END>1942</DOMAIN_MOTIF_END>
          <DOMAIN_MOTIF_START>1370</DOMAIN_MOTIF_START>
          <DOMAIN_MOTIF_END>1933</DOMAIN_MOTIF_END>
          <DOMAIN_MOTIF_START>1382</DOMAIN_MOTIF_START>
          <DOMAIN_MOTIF_END>1930</DOMAIN_MOTIF_END>
        <DOMAIN_MOTIF>
          <GO_ORGANIZING-PLINCIPLE>Molecular function</GO_ORGANIZING-PLINCIPLE>
          <GO_DB-REFERENCE_GO>0005089</GO_DB-REFERENCE_GO>
          <GO_TERM>Rho guanyl-nucleotide exchange factor activity</GO_TERM>
        </DOMAIN_MOTIF>
        <DOMAIN_MOTIF>
          <GO_ORGANIZING-PLINCIPLE>Cellular component</GO_ORGANIZING-PLINCIPLE>
          <GO_DB-REFERENCE_GO>0005622</GO_DB-REFERENCE_GO>
          <GO_TERM>intracellular</GO_TERM>
        </DOMAIN_MOTIF>
        <DOMAIN_MOTIF>
          <GO_ORGANIZING-PLINCIPLE>Biological process</GO_ORGANIZING-PLINCIPLE>
          <GO_DB-REFERENCE_GO>0035023</GO_DB-REFERENCE_GO>
          <GO_TERM>regulation of Rho protein signal transduction</GO_TERM>
        </DOMAIN_MOTIF>
        </DOMAIN>
        <DOMAIN_DB-REFERENCE_INTERPRO>IPR011046</DOMAIN_DB-REFERENCE_INTERPRO>
        <DOMAIN_NAME>WD40-like</DOMAIN_NAME>
        <DOMAIN_TYPE>Domain</DOMAIN_TYPE>
        <DOMAIN>
          <DOMAIN_MOTIF_START>2987</DOMAIN_MOTIF_START>
          <DOMAIN_MOTIF_END>3646</DOMAIN_MOTIF_END>
        </DOMAIN>
      </GENE-ONTOLOGY>
      <CELLULAR-LOCATION>
        <CELLULAR-LOCATION_DATE-LAST-UPDATE>26-Dec-2007</CELLULAR-LOCATION_DATE-LAST-UPDATE>
        <CELLULAR-LOCATION_DATE-LAST-MODIFIED>26-Dec-2007</CELLULAR-LOCATION_DATE-LAST-MODIFIED>
        <CELLULAR-LOCATION_SUBCELLULAR-RELEASE>5.0</CELLULAR-LOCATION_SUBCELLULAR-RELEASE>
        <LOCATION_WPSORT>plasma membrane</LOCATION_WPSORT>
        <LOCATION_WPSORT>endoplasmic</LOCATION_WPSORT>
        <LOCATION_WPSORT>cytosol</LOCATION_WPSORT>
        <LOCATION_WPSORT>nuclear</LOCATION_WPSORT>
        <TARGET-P>Other</TARGET-P>
        <SOSUI>membrane protein</SOSUI>
        <TMHMM>soluble protein</TMHMM>
        <PTS1>
          <LOCATION>Not targeted</LOCATION>
        </PTS1>
      </CELLULAR-LOCATION>
    </FUNCTION>
    <PROTEIN-STRUCTURE>
      <PROTEIN-STRUCTURE_DATE-LAST-UPDATE>26-Dec-2007</PROTEIN-STRUCTURE_DATE-LAST-UPDATE>
      <PROTEIN-STRUCTURE_DATE-LAST-MODIFIED>30-Mar-2007</PROTEIN-STRUCTURE_DATE-LAST-MODIFIED>
      <PROTEIN-STRUCTURE_3D-STRUCTURE-RELEASE>5.0</PROTEIN-STRUCTURE_3D-STRUCTURE-RELEASE>
      <SECONDARY-TERTIARY-STRUCTURE>
        <STRUCTURE_START>388</STRUCTURE_START>
        <STRUCTURE_END>598</STRUCTURE_END>
        <STRUCTURE_DB-REFERENCE_PDB>1by1A</STRUCTURE_DB-REFERENCE_PDB>
        <STRUCTURE_EVALUE>9e-27</STRUCTURE_EVALUE>
        <STRUCTURE_IDENTITY>18.6</STRUCTURE_IDENTITY>
        <STRUCTURE_COVERAGE>204/209</STRUCTURE_COVERAGE>
        <STRUCTURE_DOMAIN_DB-REFERENCE_SCOP>a.87.1.1</STRUCTURE_DOMAIN_DB-REFERENCE_SCOP>
        <STRUCTURE_DOMAIN_ANOMALOUS-STRUCTURE>YES</STRUCTURE_DOMAIN_ANOMALOUS-STRUCTURE>
      </SECONDARY-TERTIARY-STRUCTURE>
    </PROTEIN-STRUCTURE>
    <SEQUENCE_TRANSLATION>MDQREPLPPAPAENEMKYDTNNNEEEEGEQFDFDSGDEIPEADRQAPSAPETGGAGASEAPAPTGGEDGAGAETTPVAEPTKLVLPMKVNPYSVIDITPFQEDQPPTPVPSAEEENVGLHVPCGYLVPVPCGYAVPSNLPLLLPAYSSPVIICATSLDEEETPEVTEDRQPNSLSSEEPPTSEDQVGREDSALARWAADPANTAWMENPEEAIYDDVPRENSDSEPDEMIYDDVENGDEGGNSSLEYGWSSSEFESYEEQSDSECKNGIPRSFLRSNHKKQLSHDLTRLKEHYEKKMRDLMASTVGVVEIQQLRQKHELKMQKLVKAAKDGTKDGLERTRAAVKRGRSFIRTKSLIAQDHRSSLEEEQNLFIDVDCKHPEAILTPMPEGLSQQQVVRRYILGSVVDSEKNYVDALKRILEQYEKPLSEMEPKVLSERKLKTVFYRVKEILQCHSLFQIALASRVSEWDSVEMIGDVFVASFSKSMVLDAYSEYVNNFSTAVAVLKKTCATKPAFLEFLKQEQEASPDRTTLYSLMMKPIQRFPQFILLLQDMLKNTSKGHPDRLPLQMALTELETLAEKLNERKRDADQRCEVKQIAKAINERYLNKLLSSGSRYLIRSDDMIETVYNDRGEIVKTKERRVFMLNDVLMCATVSSRPSHDSRVMSSQRYLLKWSVPLGHVDAIEYGSSAGTGEHSRHLAVHPPESLAVVANAKPNKVYMGPGQLYQDLQNLLHDLNVIGQITQLIGNLKGNYQNLNQSVAHDWTSGLQRLILKKEDEIRAADCCRIQLQLPGKQDKSGRPTFFTAVFNTFTPAIKESWVNSLQMAKLALEEENHMGWFCVEDDGNHIKKEKHPLLVGHMPVMVAKQQEFKIECAAYNPEPYLNNESQPDSFSTAHGFLWIGSCTHQMGQIAIVSFQNSTPKVIECFNVESRILCMLYVPVEEKRREPGAPPDPETPAVRASDVPTICVGTEEGSISIYKSSQGSKKVRLQHFFTPEKSTVMSLACTSQSLYAGLVNGAVASYARAPDGSWDSEPQKVIKLGVLPVRSLLMMEDTLWAASGGQVFIISVETHAVEGQLEAHQEEGMVISHMAVSGVGIWIAFTSGSTLRLFHTETLKHLQDINIATPVHNMLPGHQRLSVTSLLVCHGLLMVGTSLGVLVALPVPRLQGIPKVTGRGMVSYHAHNSPVKFIVLATALHEKDKDKSRDSLAPGPEPQDEDQKDALPSGGAGSSLSQGDPDAAIWLGDSLGSMTQKSDLSSSSGSLSLSHGSSSLEHRSEDSTIYDLLKDPVSLRSKARRAKKAKASSALVVCGGQGHRRVHRKARQPHQEELAPTVMVWQIPLLNI*</SEQUENCE_TRANSLATION>
    <EXPRESSION>
      <EXPRESSION_DATE-LAST-UPDATE>26-Dec-2007</EXPRESSION_DATE-LAST-UPDATE>
      <EXPRESSION_DATE-LAST-MODIFIED>26-Dec-2007</EXPRESSION_DATE-LAST-MODIFIED>
      <PROBE-MAPPING>
        <PLATFORM>
          <PLATFORM-TYPE>AceGene</PLATFORM-TYPE>
          <PROBE>
            <PROBE-TYPE>AceGene</PROBE-TYPE>
            <PROBE-ID>AGhsA061219</PROBE-ID>
          </PROBE>
        </PLATFORM>
        <PLATFORM>
          <PLATFORM-TYPE>Affymetrix GeneChip</PLATFORM-TYPE>
          <PROBE>
            <PROBE-TYPE>HG-Focus</PROBE-TYPE>
            <PROBE-ID>216620_s_at</PROBE-ID>
          </PROBE>
          <PROBE>
            <PROBE-TYPE>HG-U133</PROBE-TYPE>
            <PROBE-ID>216620_s_at</PROBE-ID>
          </PROBE>
          <PROBE>
            <PROBE-TYPE>HG-U133A</PROBE-TYPE>
            <PROBE-ID>216620_s_at</PROBE-ID>
          </PROBE>
          <PROBE>
            <PROBE-TYPE>HG-U133A_2</PROBE-TYPE>
            <PROBE-ID>216620_s_at</PROBE-ID>
          </PROBE>
          <PROBE>
            <PROBE-TYPE>HG-U133_Plus_2</PROBE-TYPE>
            <PROBE-ID>216620_s_at</PROBE-ID>
          </PROBE>
          <PROBE>
            <PROBE-TYPE>HG-U95</PROBE-TYPE>
            <PROBE-ID>34180_at</PROBE-ID>
          </PROBE>
          <PROBE>
            <PROBE-TYPE>HG-U95A</PROBE-TYPE>
            <PROBE-ID>34180_at</PROBE-ID>
          </PROBE>
          <PROBE>
            <PROBE-TYPE>HG_U95Av2</PROBE-TYPE>
            <PROBE-ID>34180_at</PROBE-ID>
          </PROBE>
          <PROBE>
            <PROBE-TYPE>HuEx-1_0</PROBE-TYPE>
            <PROBE-ID>3082875</PROBE-ID>
            <PROBE-ID>3082877</PROBE-ID>
            <PROBE-ID>3082878</PROBE-ID>
            <PROBE-ID>3082882</PROBE-ID>
            <PROBE-ID>3082883</PROBE-ID>
            <PROBE-ID>3082886</PROBE-ID>
            <PROBE-ID>3082887</PROBE-ID>
            <PROBE-ID>3082888</PROBE-ID>
            <PROBE-ID>3082892</PROBE-ID>
            <PROBE-ID>3082899</PROBE-ID>
            <PROBE-ID>3082900</PROBE-ID>
            <PROBE-ID>3082901</PROBE-ID>
            <PROBE-ID>3082902</PROBE-ID>
            <PROBE-ID>3082903</PROBE-ID>
            <PROBE-ID>3082904</PROBE-ID>
            <PROBE-ID>3082908</PROBE-ID>
            <PROBE-ID>3082909</PROBE-ID>
            <PROBE-ID>3082910</PROBE-ID>
            <PROBE-ID>3082917</PROBE-ID>
            <PROBE-ID>3082919</PROBE-ID>
            <PROBE-ID>3082926</PROBE-ID>
            <PROBE-ID>3082927</PROBE-ID>
            <PROBE-ID>3082928</PROBE-ID>
            <PROBE-ID>3082929</PROBE-ID>
            <PROBE-ID>3082930</PROBE-ID>
            <PROBE-ID>3082932</PROBE-ID>
            <PROBE-ID>3082936</PROBE-ID>
            <PROBE-ID>3082937</PROBE-ID>
            <PROBE-ID>3082940</PROBE-ID>
            <PROBE-ID>3082944</PROBE-ID>
            <PROBE-ID>3082948</PROBE-ID>
            <PROBE-ID>3082950</PROBE-ID>
            <PROBE-ID>3082951</PROBE-ID>
            <PROBE-ID>3121542</PROBE-ID>
            <PROBE-ID>3121578</PROBE-ID>
            <PROBE-ID>3121579</PROBE-ID>
          </PROBE>
        </PLATFORM>
        <PLATFORM>
          <PLATFORM-TYPE>Agilent probe set</PLATFORM-TYPE>
          <PROBE>
            <PROBE-TYPE>Human 1A Oligo Microarray:PGID215</PROBE-TYPE>
            <PROBE-ID>A_23_P216282</PROBE-ID>
          </PROBE>
          <PROBE>
            <PROBE-TYPE>Whole Human Genome Oligo Microarray:PGID247</PROBE-TYPE>
            <PROBE-ID>A_23_P216282</PROBE-ID>
            <PROBE-ID>A_24_P283535</PROBE-ID>
          </PROBE>
        </PLATFORM>
      </PROBE-MAPPING>
    </EXPRESSION>
  </cDNAXML>
</H-Inv>

In bioruby:

simple access

irb(main):051:0> Bio::Hinv.hit_xml("HIT000000001")
=> "<?xml version="1.0" standalone="yes" ?> ...

and (incomplete) full access

irb(main):005:0> serv = Bio::Hinv::HitXML.new
irb(main):006:0> serv.query("hit" =>"HIT000000001")
irb(main):007:0> serv.result
=> "Rho guanine nucleotide exchange factor 10."
irb(main):071:0> a.instance_eval { @xml.elements.each("//MOL-TYPE") {|x| p x.text } }
"mRNA"
=> [<MOL-TYPE> ... </>]

hix2hit - HIT ID of HIT ID

URI:

Output:

<?xml version='1.0' encoding='UTF-8'?>
<H-Inv>
<H-INVITATIONAL-ID>HIT000012846</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022124</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000007722</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000281202</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000293297</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000283989</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000299690</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000284643</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000280349</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000297167</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000274447</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000301319</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000293727</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000261011_01</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000339817</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000301513</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000088658_01</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000393264</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000262478</H-INVITATIONAL-ID>
</H-Inv>

In bioruby:

irb(main):007:0> Bio::Hinv.hix2hit("HIX0000001")
=> ["HIT000022181"]
|ruby|<

** hix_cnt - total number of HIX ID
URI:
- http://jbirc.jbic.or.jp/hinv/hws/hix_cnt.php

Output:
>|xml|
<?xml version='1.0' encoding='UTF-8'?>
<H-Inv>
        <LOCUS_CNT>36073</LOCUS_CNT>
</H-Inv>

In bioruby:

irb(main):078:0> Bio::Hinv.hix_cnt
=> 36073

hix_represent - representative HIT ID of HIX ID

URI:

Output:

<?xml version='1.0' encoding='UTF-8'?>
<H-Inv>
        <LOCUS>
                <CLUSTER-ID>HIX0000001</CLUSTER-ID>
                <REP-H-INVITATIONAL-ID>HIT000022181</REP-H-INVITATIONAL-ID>
                <REP-ACCESSION-NO>AK097327</REP-ACCESSION-NO>
        </LOCUS>
</H-Inv>

In bioruby:

irb(main):079:0> Bio::Hinv.hix_represent("HIX0000001")
=> "HIT000022181"
irb(main):081:0> serv=Bio::Hinv::HixRepresent.new
irb(main):082:0> serv.query("hix"=>"HIX0000001")
irb(main):085:0> serv.rep_accession_no
=> "AK097327"
irb(main):086:0> serv.rep_h_invitational_id
=> "HIT000022181"

hix_xml - HIX XML file of HIX ID

URI:

Output:



			

In bioruby:



			

id_search - HIT ID of any ID

URI:


Output:

<?xml version='1.0' encoding='UTF-8'?>
<HINVDB_SEARCH>
<QUERY>HIT00002218*</QUERY>
<ID_TYPE>H-INVITATIONAL-ID</ID_TYPE>
<SIZE>8</SIZE>
<START>1</START>
<END>8</END>
<H-INVITATIONAL-ID>HIT000022181</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022184</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022189</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022180</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022185</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022183</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022188</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022186</H-INVITATIONAL-ID>
</HINVDB_SEARCH>||<

In bioruby:
>|ruby|
irb(main):088:0> Bio::Hinv.id_search("HIT00002218*")
=> ["HIT000022181", "HIT000022184", "HIT000022189", "HIT000022180", "HIT000022185", "HIT000022183", "HIT000022188", "HIT000022186"]
irb(main):090:0> serv = Bio::Hinv::IdSearch.new
irb(main):093:0> serv.query("query" => "HIT00002218*", "start" => "1", "end" => "100")

keyword_search - HIT ID of any ID

URI:


Output:

<?xml version='1.0' encoding='UTF-8'?>
<HINVDB_SEARCH>
<QUERY>HIT00002218*</QUERY>
<SIZE>8</SIZE>
<START>1</START>
<END>8</END>
<H-INVITATIONAL-ID>HIT000022180</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022181</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022183</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022184</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022185</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022186</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022188</H-INVITATIONAL-ID>
<H-INVITATIONAL-ID>HIT000022189</H-INVITATIONAL-ID>
</HINVDB_SEARCH>

In bioruby:

irb(main):089:0> Bio::Hinv.keyword_search("HIT00002218*")
=> ["HIT000022180", "HIT000022181", "HIT000022183", "HIT000022184", "HIT000022185", "HIT000022186", "HIT000022188", "HIT000022189"]
irb(main):090:0> serv = Bio::Hinv::KeywordSearch.new
irb(main):093:0> serv.query("query" => "HIT00002218*", "start" => "1", "end" => "100")

Summary

  1. Classes for H-InvDB REST web service are available on BioRuby CVS HEAD.
  2. Access methods for some complicated outputs are no implemented.
  3. URI design of the H-InvDB REST web service is not good. For example, acc2hit api contains redundunt "acc" term twice (http://jbirc.jbic.or.jp/hinv/hws/acc2hit.php?acc=BC053657).
トラックバック - http://bioruby.g.hatena.ne.jp/nakao_mitsuteru/20080110